The LightScanner^® is a machine from Idaho Technology Inc. for high throughput genotyping and mutation screening. The technology is based on high resolution melting curve analysis (HRMA). The use of this technology can considerably facilitate genetic analysis and positional cloning. Detection of sequence polymorphisms with the LightScanner^® does not require loading samples on a gel, restriction etc. Scanning with the LightScanner^® is not destructive for amplified DNA, therefore you can run several analyses with the prepared plates and use analyzed PCR product for all subsequent manipulations such as sequencing or digestion.

The Plant-Microbe Interactions group has the LightScanner^® in Kruyt building. In order to make an easy access to information about how to use the LightScanner^® we designed this web-site. Here you can find all information you need to run HRMA with the LightScanner^®

At this moment information about unlabeled probes is not complete. We are working on it.

Introduction to High Resolution Melting Curve (HRMC) analysis with the LightScanner®

Melting of DNA molecules at certain temperature depends on their nucleotide sequences. Detection of the melting process can be done using fluorescent dyes which specifically bind to dsDNA. Upon heating dsDNA is denaturated, the dye is released resulting to a lower level of fluorescence. For instance, this approach is widely used to check a specificity of primer sets in qPCR with CYBER Green®. If several different products are formed during PCR melting curves with several melting domains are likely to appear. The melting analysis with the LightScanner® uses the same approach but different fluorescent dye, LCGreen Plus+. That allows to perform high resolution melting analysis. On a figure below you can see decrease in the level of fluorescence upon heating DNA sample from 80 to 89°C.

In principle, any mutation in DNA sequence can be detected with the LightScanner®. It can be single nucleotide mutation (SNP), insertion-deletion mutation (indel), repeated sequences (e.g. SSR). Also DNA molecules of different size can be distinguished based on their melting properties.

Let’s consider the following example: detection of SNP in a DNA fragment of around 80 bp.

A wild type allele is different from a mutant allele in C changed into T (highlighted in red).

CTTGCCGATGTCAACCATAGGAATCCGAGGGGATATACGGTGCTTC
ATGTTGCTGCGATGCGGAAGGAGCCACAATTGATA

This nucleotide change leads to a small but detectable difference in the melting curves of wild type and mutant allele. In the figure above the mutant melting curve is red, the wild type is grey.

The procedure of HRMC includes PCR in order amplify target DNA sequences and thereby increase the fluorescent signal. Since LCGreen Plus+ is an unspecific DNA binding dye unspecific amplification can significantly reduce the power of the analysis. Therefore it is important to optimize every new primer set with gradient PCR to find an appropriate annealing temperature.

Resolution of HRMC is dependent on several factors:

1. How big a difference between wild type and mutant allele is. For instance, in case of SNPs mutation G->T is much easier to detect than A->T.
2. Size of melted DNA molecule. The highest resolution is achieved when fragments of 60-100 bp are analyzed. The limit for this method is about 400 bp. The highest resolution can be obtained with DNA fragments up to 100 bp.
3. How well an HRMC assay was designed. Unspecific DNA fragments can significantly reduce the resolution due to introduction of additional melting domains.

Melting of PCR product and detecting Tm differences is a very basic protocol but it is not powerful enough to detect small shifts in melting temperatures of less than 0.3°C. In this case another more precise and sophisticated technique can be used. It is based on the application of unlabeled probes. For instance, we would like to detect A->T change in DNA sequence. We design a probe which binds specifically to the region with the mutation. The probe is added before PCR starts therefore it has to be blocked on 3′ end to prevent use of this probe as a primer. After PCR duplexes are formed. The probe binds to the region with the mutation. Melting is performed and melting curves with several melting domains appear. In principle it is explained by the fact that the probe is usually 20-25 bp long and therefore Tm for PCR product-probe hybrid is lower than for PCR product-PCR product duplex. Since the probe is short hybrids with wild type and and mutant variant DNA differ more than in case without the probe.

There are other interesting applications for HRMA, for example, distinguishing PCR products of different size, determination of a level of methylation etc.

For more details please refer to articles (1,2,3) or guidelines and tips on the home page.